Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone
作者： Koshi Hashimoto , Masanobu Yamada , Shunichi Matsumoto , Tsuyoshi Monden , Teturou Satoh
DOI: 10.1210/EN.2006-0116
关键词:
摘要: Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays pivotal role in the transcriptional regulation different lipogenic genes mediating lipid synthesis. In previous studies, SREBP-1c mRNA levels by thyroid hormone has remained controversial. this study, we examined whether T3 regulates mouse expression. We found that negatively gene expression liver, as shown ribonuclease protection assays real-time quantitative RT-PCR. Promoter analysis with luciferase using HepG2 Hepa1–6 cells revealed promoter (−574 to +42) Site2 (GCCTGACAGGTGAAATCGGC) located around start site responsible for negative T3. Gel shift showed retinoid X receptor-α/thyroid receptor-β heterodimer bound Site2, but receptor-α/liver receptor-α heterodimer...
oup.com
endojournals.org参考文章(48)
Sadako Suzuki, Hiroko Misawa, Hirotoshi Nakamura, Kotaro Kawai, Takeshi Ito, Hiroshi Morita, Shigekazu Sasaki, Unliganded Thyroid Hormone Receptor- 1 Represses Liver X Receptor /Oxysterol-Dependent Transactivation ,(2004)
P.B. Hylemon, E.C. Gurley, R.T. Stravitz, J.S. Litz, W.M. Pandak, J.Y. Chiang, Z.R. Vlahcevic, Hormonal regulation of cholesterol 7 alpha-hydroxylase mRNA levels and transcriptional activity in primary rat hepatocyte cultures. Journal of Biological Chemistry. ,vol. 267, pp. 16866- 16871 ,(1992) , 10.1016/S0021-9258(18)41864-9
T R Flynn, A N Hollenberg, O Cohen, J B Menke, S J Usala, S Tollin, M K Hegarty, F E Wondisford, A novel C-terminal domain in the thyroid hormone receptor selectively mediates thyroid hormone inhibition. Journal of Biological Chemistry. ,vol. 269, pp. 32713- 32716 ,(1994) , 10.1016/S0021-9258(20)30048-X
N Toyoda, A M Zavacki, A L Maia, J W Harney, P R Larsen, A novel retinoid X receptor-independent thyroid hormone response element is present in the human type 1 deiodinase gene. Molecular and Cellular Biology. ,vol. 15, pp. 5100- 5112 ,(1995) , 10.1128/MCB.15.9.5100
H Y Park, D Davidson, B M Raaka, H H Samuels, The herpes simplex virus thymidine kinase gene promoter contains a novel thyroid hormone response element. Molecular Endocrinology. ,vol. 7, pp. 319- 330 ,(1993) , 10.1210/MEND.7.3.8387156
Koshi Hashimoto, Ronald N. Cohen, Masanobu Yamada, Kathleen R. Markan, Tsuyoshi Monden, Teturou Satoh, Masatomo Mori, Fredric E. Wondisford, Cross-talk between thyroid hormone receptor and liver X receptor regulatory pathways is revealed in a thyroid hormone resistance mouse model. Journal of Biological Chemistry. ,vol. 281, pp. 295- 302 ,(2006) , 10.1074/JBC.M507877200
M. S. Brown, J. L. Goldstein, A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood Proceedings of the National Academy of Sciences of the United States of America. ,vol. 96, pp. 11041- 11048 ,(1999) , 10.1073/PNAS.96.20.11041
Ana Cachefo, Philippe Boucher, Caroline Vidon, Eric Dusserre, Frédérique Diraison, Michel Beylot, Hepatic lipogenesis and cholesterol synthesis in hyperthyroid patients. The Journal of Clinical Endocrinology and Metabolism. ,vol. 86, pp. 5353- 5357 ,(2001) , 10.1210/JCEM.86.11.7981
Anders Berkenstam, Mathias Färnegårdh, Jan-Åke Gustafsson, Convergence of Lipid Homeostasis Through Liver X and Thyroid Hormone Receptors Mechanisms of Ageing and Development. ,vol. 125, pp. 707- 717 ,(2004) , 10.1016/J.MAD.2004.05.005
Koshi Hashimoto, Kerstin Zanger, Anthony N. Hollenberg, Laurie E. Cohen, Sally Radovick, Fredric E. Wondisford, cAMP response element-binding protein-binding protein mediates thyrotropin-releasing hormone signaling on thyrotropin subunit genes Journal of Biological Chemistry. ,vol. 275, pp. 33365- 33372 ,(2000) , 10.1074/JBC.M006819200