A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease
作者： Y.-B. Pan , M. P. Grisham , D. M. Burner , K. E. Damann , Q. Wei
DOI: 10.1094/PDIS.1998.82.3.285
关键词:
摘要: A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from intergenic transcribed spacer (ITS) region 16S-23S ribosomal DNA C. and cynodontis were cloned sequenced. Based on a multiple sequence alignment among these two sequences other nonredundant highly homologous database, xyli-specific primers designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) Cxx2 ACCCTGTGTTGTTTTCAACG). These 20-mer oligonucleotides primed specific amplification 438-bp product genomic samples 21 strains. Amplification not observed with one strain, five strains four species, Rathayibacter species. The also amplified directly cultured cells xyli-infected vascular sap unique buffer containing polyvinylpyrrolidone ficoll. Extraction necessary prior to assay.
cabdirect.org
apsnet.org
sci-hub.se 参考文章(26)
H. Koike, G. T. A. Benda, A. G. Gillaspie, Cane yield response to ratoon stunting disease. International Sugar Journal. ,vol. 84, pp. 131- 133 ,(1982)
M C Metzler, Y P Zhang, T A Chen, Transformation of the gram-positive bacterium Clavibacter xyli subsp. cynodontis by electroporation with plasmids from the IncP incompatibility group. Journal of Bacteriology. ,vol. 174, pp. 4500- 4503 ,(1992) , 10.1128/JB.174.13.4500-4503.1992
M A Jensen, J A Webster, N Straus, Rapid identification of bacteria on the basis of polymerase chain reaction-amplified ribosomal DNA spacer polymorphisms. Applied and Environmental Microbiology. ,vol. 59, pp. 945- 952 ,(1993) , 10.1128/AEM.59.4.945-952.1993
M. J. Davis, Properties and Relationships of Two Xylem-Limited Bacteria and a Mycoplasmalike Organism Infecting Bermuda Grass Phytopathology. ,vol. 73, pp. 341- ,(1983) , 10.1094/PHYTO-73-341
Jens Dreier, Southern Hybridization and PCR for Specific Detection of PhytopathogenicClavibacter michiganensissubsp.michiganensis Phytopathology. ,vol. 85, pp. 462- 468 ,(1995) , 10.1094/PHYTO-85-462
Xiang Li, Selection of Polymerase Chain Reaction Primers from an RNA Intergenic Spacer Region for Specific Detection ofClavibacter michiganensissubsp.sepedonicus Phytopathology. ,vol. 85, pp. 837- 842 ,(1995) , 10.1094/PHYTO-85-837
C. H. Chung, C. P. Lin, C. T. Chen, Development and Application of Cloned DNA Probes for Clavibacter xyli subsp. xyli, the Causal Agent of Sugarcane Ratoon Stunting Journal of Phytopathology. ,vol. 141, pp. 293- 301 ,(1994) , 10.1111/J.1439-0434.1994.TB01473.X
Donald J. MacKenzie, Morven A. McLean, Srima Mukerji, Margaret Green, Improved RNA Extraction from Woody Plants for the Detection of Viral Pathogens by Reverse Transcription-Polymerase Chain Reaction. Plant Disease. ,vol. 81, pp. 222- 226 ,(1997) , 10.1094/PDIS.1997.81.2.222
N. A. Harrison, Colonization of Vascular Tissues byClavibacter xylisubsp.xyliin Stalks of Sugarcane Cultivars Differing in Susceptibility to Ratoon Stunting Disease Phytopathology. ,vol. 78, pp. 722- 727 ,(1988) , 10.1094/PHYTO-78-722
M. J. Davis, Direct-Count Techniques for EnumeratingClavibacter xylisubsp.xyliWhich Causes Ratoon Stunting Disease of Sugarcane Phytopathology. ,vol. 75, pp. 1226- 1231 ,(1985) , 10.1094/PHYTO-75-1226