Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer
作者： Sung Ok Yoon , D. M. Chikaraishi
DOI: 10.1016/S0021-9258(17)32330-X
关键词: Tyrosine hydroxylase 、 Transfection 、 Phosphorylation 、 Amino acid 、 Dyad symmetry 、 E-box binding 、 Molecular biology 、 Biology 、 Regulatory sequence 、 Enhancer
摘要: The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 -182) whose core E-box. We have isolated two partial cDNA clones that encode factors which bind TH-dyad. One rITF2 with a basic helix-loop-helix other CDP2 homeodomain. homolog human ITF2 (or E2-2), member new family homeoproteins defined by histidine as 9th residue recognition helix unique 64 amino acid repeats related those Drosophila cut gene. binding affinity alone relatively weak, but it enhances In transfected F9 cells, activation TH-driven reporter requires both CDP2, suggesting proteins may functionally interact. However, are not restricted TH-expressing tissues; hence they be involved tissue-specific expression TH. addition, phosphorylated vitro vivo.
sci-hub.st 参考文章(41)
A. Percival-Smith, M. Müller, M. Affolter, W. J. Gehring, The interaction with DNA of wild-type and mutant fushi tarazu homeodomains. The EMBO Journal. ,vol. 9, pp. 3967- 3974 ,(1990) , 10.1002/J.1460-2075.1990.TB07617.X
G. Superti-Furga, A. Barberis, G. Schaffner, M. Busslinger, The -117 mutation in Greek HPFH affects the binding of three nuclear factors to the CCAAT region of the gamma-globin gene. The EMBO Journal. ,vol. 7, pp. 3099- 3107 ,(1988) , 10.1002/J.1460-2075.1988.TB03176.X
B Corneliussen, A Thornell, B Hallberg, T Grundström, Helix-loop-helix transcriptional activators bind to a sequence in glucocorticoid response elements of retrovirus enhancers. Journal of Virology. ,vol. 65, pp. 6084- 6093 ,(1991) , 10.1128/JVI.65.11.6084-6093.1991
D.G. Skalnik, E.C. Strauss, S.H. Orkin, CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter. Journal of Biological Chemistry. ,vol. 266, pp. 16736- 16744 ,(1991) , 10.1016/S0021-9258(18)55363-1
Guy Riddihough, Homing in on the homeobox Nature. ,vol. 357, pp. 643- 644 ,(1992) , 10.1038/357643A0
G Bain, S Gruenwald, C Murre, E2A and E2-2 are subunits of B-cell-specific E2-box DNA-binding proteins. Molecular and Cellular Biology. ,vol. 13, pp. 3522- 3529 ,(1993) , 10.1128/MCB.13.6.3522
Françoise Javaux, Alena Donda, Gilbert Vassart, Daniel Christophe, Cloning and sequence analysis of TFE, a helix-loop-helix transcription factor able to recognize the thyroglobulin gene promoter in vitro Nucleic Acids Research. ,vol. 19, pp. 1121- 1127 ,(1991) , 10.1093/NAR/19.5.1121
P Henthorn, M Kiledjian, T Kadesch, Two distinct transcription factors that bind the immunoglobulin enhancer microE5/kappa 2 motif Science. ,vol. 247, pp. 467- 470 ,(1990) , 10.1126/SCIENCE.2105528
E. J. Lewis, C. A. Harrington, D. M. Chikaraishi, Transcriptional regulation of the tyrosine hydroxylase gene by glucocorticoid and cyclic AMP. Proceedings of the National Academy of Sciences of the United States of America. ,vol. 84, pp. 3550- 3554 ,(1987) , 10.1073/PNAS.84.11.3550
Bernard Binétruy, Tod Smeal, Michael Karin, Ha-Ras augments c-Jun activity and stimulates phosphorylation of its activation domain Nature. ,vol. 351, pp. 122- 127 ,(1991) , 10.1038/351122A0