Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2 gene that is essential for expression
作者： Hye-Min Lim , Jung-Il Cho , Sichul Lee , Man-Ho Cho , Seong Hee Bhoo
DOI: 10.1007/S00299-006-0272-9
关键词: Biology 、 Genetically modified crops 、 Gene expression 、 Arabidopsis 、 Gene 、 Stamen 、 Nucleotide 、 Biochemistry 、 Cotyledon 、 Pyrophosphate
摘要: Arabidopsis harbors two α and β genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns the AtPFPα were analyzed using transgenic plants containing a promoter::s-glucuronidase (GUS) fusion construct. Whereas AtPFPα1 promoter was found to be ubiquitously active in all tissues, AtPFPα2 is preferentially expressed specific heterotrophic regions plant such as trichomes leaves, cotyledon veins, roots, stamen gynoecium flowers. Serial deletion analysis identified key regulatory element from nucleotides −194 −175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPα2 essential for gene expression. Using GUS construct driven by this 20-bp sequence conjunction with −46 CaMV35S minimal promoter, also demonstrate that sufficient normal Hence, can not only used isolate DNA-binding protein(s) control carbon metabolic enzyme AtPFPα2, but has potential utilized production useful compounds organ leaf trichomes.
springer.com
sci-hub.se 参考文章(37)
S.O Duke, C Canel, A.M Rimando, M.R Telle, M.V Duke, R.N Paul, Current and potential exploitation of plant glandular trichome productivity Advances in Botanical Research. ,vol. 31, pp. 121- 151 ,(2000) , 10.1016/S0065-2296(00)31008-4
Annemarie S. Buchel, Frans Th. Brederode, John F. Bol, Huub J.M. Linthorst, Mutation of GT-1 binding sites in the Pr-1A promoter influences the level of inducible gene expression in vivo Plant Molecular Biology. ,vol. 40, pp. 387- 396 ,(1999) , 10.1023/A:1006144505121
S M Carlisle, S D Blakeley, S M Hemmingsen, S J Trevanion, T Hiyoshi, N J Kruger, D T Dennis, Pyrophosphate-dependent phosphofructokinase. Conservation of protein sequence between the alpha- and beta-subunits and with the ATP-dependent phosphofructokinase. Journal of Biological Chemistry. ,vol. 265, pp. 18366- 18371 ,(1990) , 10.1016/S0021-9258(17)44761-2
Jong-Seong Jeon, Yong-Yoon Chung, Sichul Lee, Gi-Hwan Yi, Byeong-Geun Oh, Gynheung An, None, Isolation and characterization of an anther-specific gene, RA8, from rice (Oryza sativa L.). Plant Molecular Biology. ,vol. 39, pp. 35- 44 ,(1999) , 10.1023/A:1006157603096
R. A. Jefferson, T. A. Kavanagh, M. W. Bevan, GUS fusions: beta‐glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The EMBO Journal. ,vol. 6, pp. 3901- 3907 ,(1987) , 10.1002/J.1460-2075.1987.TB02730.X
Hsi-Chou Liu, Roy G. Creech, Johnie N. Jenkins, Din-Pow Ma, Cloning and promoter analysis of the cotton lipid transfer protein gene Ltp311The nucleotide sequence data reported will appear in the GenBank Nucleotide Sequence Databases under the accession number AF228333. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids. ,vol. 1487, pp. 106- 111 ,(2000) , 10.1016/S1388-1981(00)00072-X
Nicholas J. Kruger, David T. Dennis, Molecular properties of pyrophosphate:Fructose-6-phosphate phosphotransferase from potato tuber Archives of Biochemistry and Biophysics. ,vol. 256, pp. 273- 279 ,(1987) , 10.1016/0003-9861(87)90446-2
Tom Nielsen, Mark Stitt, Tobacco transformants with strongly decreased expression of pyrophosphate:fructose-6-phosphate expression in the base of their young growing leaves contain much higher levels of fructose-2,6-bisphosphate but no major changes in fluxes. Planta. ,vol. 214, pp. 106- 116 ,(2001) , 10.1007/S004250100591
J.F. Todd, S.D. Blakeley, D.T. Dennis, Structure of the genes encoding the α- and β-subunits of castor pyrophosphate-dependent phosphofructokinase Gene. ,vol. 152, pp. 181- 186 ,(1995) , 10.1016/0378-1119(94)00646-A
Yue-Hao Wang, Jiao-Nai Shi, Evidence that fructose 1,6‐bisphosphate specifically protects the α‐subunit of pyrophosphate‐dependent 6‐phosphofructo‐1‐phosphotransferase against proteolytic degradation FEBS Letters. ,vol. 459, pp. 448- 452 ,(1999) , 10.1016/S0014-5793(99)01304-6