Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

摘要: Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they poorly understood with regard to their genomic make-up expression profiles. Through the analysis full-length cDNAs from a species, we found conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced mRNAs sp. Using primer derived Eut-SL, constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering ∼1.9×106 original reads (average length 382 bp) yielded 36,643 transcripts. Although only 28% transcripts matched documented genes, this fraction represents functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in alga’s transcriptome. The seemed have short 5′- untranslated regions, estimated be 21 nucleotides on average. Among biochemical pathways represented transcriptome obtained, carbonic anhydrase genes known function C4 pathway heterotrophic carbon fixation were found, posing question whether employs multifaceted strategies acquire fix efficiently. This first large-scale transcriptomic dataset euglenoid uncovers many potential novel overall offers valuable genetic resource research algae.