Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid

作者: Jean W Eastcott , Cynthia J Holmberg , Floyd E Dewhirst , Thomas R Esch , Daniel J Smith

DOI: 10.1016/S0264-410X(00)00422-9

关键词:

摘要: Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation macrophages thus stimulation the immune system. We tested an oligonucleotide dinucleotide flanked by two 5' purines 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for ability to affect antibody levels tetanus toxoid (Tt). Groups male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound Al(OH)3, Al(OH)3 addition oligonucleotide. Antigens were administered subcutaneously in salivary gland vicinity once, gastric intubation on 3 consecutive days. On day 124 all animals given a boost same material route. Serum IgG saliva IgA was determined ELISA. significantly higher ODN+Tt treated than Tt-alone immunized route after primary booster immunizations. Thus, administration ODN motifs along immunogen can result enhanced specific when intragastric as well subcutaneous routes.

参考文章(30)
Q Zhao, T Waldschmidt, E Fisher, CJ Herrera, AM Krieg, Stage-specific oligonucleotide uptake in murine bone marrow B-cell precursors. Blood. ,vol. 84, pp. 3660- 3666 ,(1994) , 10.1182/BLOOD.V84.11.3660.BLOODJOURNAL84113660
Rajesh K. Gupta, Bradford E. Rost, Edgar Relyveld, George R. Siber, Adjuvant Properties of Aluminum and Calcium Compounds Vaccine Design. ,vol. 6, pp. 229- 248 ,(1995) , 10.1007/978-1-4615-1823-5_8
J H Chace, A M Krieg, A K Yi, J S Cowdery, Bacterial DNA induces NK cells to produce IFN-gamma in vivo and increases the toxicity of lipopolysaccharides. Journal of Immunology. ,vol. 156, pp. 4570- 4575 ,(1996)
O E Obeid, M W Steward, C D Partidos, Antibody responses to non-immunogenic synthetic peptides induced by co-immunization with immunogenic peptides. Immunology. ,vol. 77, pp. 262- 266 ,(1992)
M J Sweet, David Hume, K J Stacey, Macrophages ingest and are activated by bacterial DNA. Journal of Immunology. ,vol. 157, pp. 2116- 2122 ,(1996)
SARA MATSON, ARTHUR M. KRIEG, Nonspecific Suppression of [3H]Thymidine Incorporation by "Control" Oligonucleotides Antisense research and development. ,vol. 2, pp. 325- 330 ,(1992) , 10.1089/ARD.1992.2.325
Hermann Wagner, Susanne Hausmann, Martin Röcken, Grayson B. Lipford, Klaus Heeg, Oliver Egeter, Stefan Zimmermann, CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis. Journal of Immunology. ,vol. 160, pp. 3627- 3630 ,(1998)
Gunther Hartmann, Arthur M. Krieg, Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells The Journal of Immunology. ,vol. 164, pp. 944- 953 ,(2000) , 10.4049/JIMMUNOL.164.2.944